Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action

Pyridinium chlorochromate chemistry. New insight into oxidation of tetrahydrofurans

A thorough investigation of the minor oxidation products of two penta-tetrahydrofuran compounds with pyridinium chlorochromate has been carried out. Isolation of ring-B oxygenated spiroketal and degradation products, including polycyclic mono- and bis-lactone compounds, supports the previously postulated involvement of cyclic enolether intermediates in the oxidation of THF and poly-THF substances with PCC. Based on the collected evidence, a new mechanistic route for the PCC-mediated oxidative cleavage of α-hydroxy-THF compounds to γ-lactones has been postulated. The proposed mechanism well agrees with the one reported for the oxidative cleavage of 8-hydroxy-neoisocedranol oxide by RuO4, a fact that further supports our previous observation on the similar oxidizing behaviour shown by PPC and RuO4 towards THFcontaining compounds

Synthesis, self-assembly-behavior and biomolecular recognition properties of thyminyl dipeptides

This article describes the synthesis of Thy-(Phe-Phe) and Thy-(Tyr-Tyr), two thymine-bearing dipeptides based on L-phenylalanine and L-tyrosine, the circular dichroism (CD), UV and dynamic light scattering (DLS) characterization of their self-assemblies, and a CD study of their interaction with nucleic acids (using homoadenine DNA and RNA) and serum proteins (employing BSA as model protein). DLS studies, alongside with CD and UV investigations conducted on aqueous solutions of the derivatives under different concentration and temperature conditions, showed the formation of extensive molecular architectures with hydrodynamic mean diameters higher than 300 nm, with Thy-(Tyr-Tyr) forming at pH=7.5 particularly large and stable networks, involving multiple units, connected by H-bonding, aromatic and hydrophobic interactions. Finally, the findings of our study suggested that Thy-(Phe-Phe) and Thy-(Tyr-Tyr), very stable in human serum, were able to bind BSA protein altering its secondary structure

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic

Design and Synthesis of a cADPR Mimic as a Novel Tool for Monitoring the Intracellular Ca2+ Concentration

Cyclic ADP-ribose (cADPR, 1, Figure 1) is a naturally occurring metabolite of NAD+ capable of mobilizing Ca2+ ions from intracellular stores. It was firstly isolated from sea urchin egg extract, but it was later established that it is also produced in many other mammalian cells, including pancreatic β-cells, T-lymphocytes, smooth and cardiac muscle cells, and cerebellar neurons, acting as a Ca2+-mobilizing agent. For this activity, cADPR has been classified as a second messenger that, by activating the ryanodine receptors of the sarcoplasmatic reticulum, is able to mobilize the calcium ions from intracellular stores. cADPR is involved in many physiological processes related to variation in the Ca2+ concentration, such as synaptic homeostasis in neurons as well as fertilization and cellular proliferation. This cyclic nucleotide, characterized by a very labile glycosidic bond at N1, is also rapidly hydrolysed in neutral aqueous solutions to inactive ADP-ribose. Matsuda and co-workers [1] were the first to synthesize new analogues of cADPR in which the adenine base is replaced by a hypoxanthine ring. This kind of modification produced the cyclic inosine diphosphate ribose (cIDPR), which proved to be stable in hydrolytic physiological conditions and showed significant Ca2+ mobilizing activity. Many modifications regarding the northern and southern ribose, as well as the purine base of cADPR, have been proposed so far. In our laboratories, we have synthesized several analogues of cIDPR [2–7]. In particular, the analogue with the northern ribose replaced by a pentyl chain (cpIDP) showed interesting Ca2+ mobilizing activity on the neuronal PC12 cell line [2]. Starting from these results, we report here the synthesis of the novel analogue 2, in which the “northern” ribose of cIDPR is replaced by a 2″,3″-dihydroxy pentyl chain. The effect of the presence of the diol moiety on the intracellular Ca2+ release will be assessed in due course

Nanogravimetric and Optical Characterizations of Thrombin Interaction with a Self-Assembled Thiolated Aptamer

Efficient biorecognition of thrombin (TB), a serine protease with crucial role in physiological and pathological blood coagulation, is a hot topic in medical diagnostics. In this work, we investigate the ability of synthetic thrombin aptamer (TBA), immobilized on a gold substrate, to bind thrombin by two different label-free techniques: the quartz crystal microbalance (QCM) and the spectroscopic ellipsometry (SE). By QCM characterization in the range from 20 to 110 nM, we demonstrate high specificity of TBA-TB interaction and determine affinity constant (Kd) of 17.7 ± 0.3 nM, system sensitivity of 0.42 ± 0.03 Hz nM-1, and limit of detection (LOD) of 240 ± 20 pM. The interaction between TBA and TB is also investigated by SE, an all-optical method, by quantifying the thickness increase of the TBA film assembled on gold substrate. AFM characterization of TBA and TB molecules deposited on flat silicon surface is also supplied

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1′-uracilyl)-2-propanone on Serum Albumin Structure

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δβ-turn + Δβ-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Synthesis and Biological Evaluation of a New Structural Simplified Analogue of cADPR, a Calcium-Mobilizing Secondary Messenger Firstly Isolated from Sea Urchin Eggs

Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca2+-releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca2+release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca2+release properties